-
br General procedure for urea synthesis from
2020-08-04
5.1.2. General procedure for urea synthesis from isocyanates The appropriately substituted aryl isocyanate (1.40 mmol) was added to a suspension of amine 13a (1.33 mmol) in anhydrous tetra-hydrofuran (15 mL) under a nitrogen atmosphere. The mixture was stirred at room temperature for 4 h and th
-
br Apoptosis assay br T
2020-08-04
2.5. Apoptosis assay 4T1 cells were cultured in the presence or absence of ART (100 μM) for 48 h in 96-well plates at a concentration of 1 × 106 cells/mL. To detect apoptosis, the cells were stained using an Annexin-V Apoptosis Detection kit I (BD Biosciences) and subsequently evaluated by flow
-
br that the mice were divided into six
2020-08-03
that, the mice were divided into six groups and treated respectively as we described previously (Fig. 3). 3.4. Inhibition of lymphatic metastasis by lymphatic chemotherapy Abundant lymphatic vessels are located in the footpad of nude mouse, which form unidirectional lymphatic drainage. Thus,
-
Echinomycin br This study used breast cancer
2020-08-02
This study used breast cancer cell lines the MCF-7 as the experi-mental cancer Echinomycin (ATCC No: HTB-22™), and VERO cell line (ATCC® No: CCL-81™) as a control cell line. These cells were obtained from American type Collection Culture. Frozen cells were thawed and in-oculated into 5 mL of Dulbe
-
br mitochondrial anti apoptotic protein Bcl in a dose depend
2020-07-31
mitochondrial anti-apoptotic protein Bcl-2 in a dose-dependent manner (Fig. 7a). Compared with the experimental group, the protein level of Bcl-2 was significantly down-regulated after the exposure to 5-FU. In addition, the protein level of Bax was gradually up-regulated with the intervention of C
-
br mechanism is still unknown AAMP expression is
2020-07-29
mechanism is still unknown [12]. AAMP expression is increased in a number of cancer Fluxametamide like invasive gastrointestinal and breast carci-noma cells; it is considered a marker of poor prognosis [13,14]. The epidermal growth factor receptor (EGFR), which is anchored in the cytoplasmic memb
-
br more toxic products triene conjugates
2020-07-28
more toxic products (triene conjugates, Schiff bases), which is con-firmed by the corresponding correlation coefficients (Table 5). It should also be noted that for MDA, the correlation coefficients in normal and in cancer pathology have different signs. Normally, an increase in the intensity of the Jas
-
br ACCEPTED MANUSCRIPT br Subgroup analysis br As
2020-07-28
ACCEPTED MANUSCRIPT Subgroup analysis As the therapeutic indications for ERCP are more common in biliary strictures and published data show differences in diagnostic sensitivity according to location, we next analyzed the data separating biliary and pancreatic malignant samples. Sensitivity
-
br We have recently shown
2020-07-27
We have recently shown that incorporation of a thiazole-or-ange-20-deoxyuridine conjugate, dUTO, 1 (Fig. 1) into an oligonu-cleotide probe targeting cyclin D1 mRNA (a breast cancer marker) allowed the sensitive detection of the target based on a 7-fold enhanced fluorescence of the probe. Fluoresce
-
br Grant Support This work was supported in part by
2020-07-27
1 Grant Support: This work was supported in part by Grant CP120017 from the Cancer Prevention and Research Institute of Texas to Asuragen (PI: G.J.L.), by the National Institute of Environmental Health Sciences of the National Institutes of Health under award number R43ES024365 (PI: B.C.H.), and b
-
br arrest with altered cell membrane and nuclear
2020-07-27
arrest with altered cell membrane and nuclear integrity in MDA-MB-231 cancer cells. A schematic model illustrating the possible mechanism of WSPF induced apoptosis is shown in Fig. 10. The present results do suggest future characterization of WSPF for the effective therapeutically active protei
-
br DNA using the ReverTra Ace
2020-07-26
DNA using the ReverTra Ace qPCR RT Kit (TOYOBO). Quantitative PCR was performed with SYBR Green Realtime PCR Master Mix (TOYOBO) and quantified by the Step One Real-Time PCR System (Applied Biosystems). Primers for real-time PCR are shown in Key Resources Table. Immunoprecipitation (IP) and Wes
-
LY3009120 br were stained with crystal violet and their area
2020-07-06
445 were stained with 0.5% crystal violet, and their areas were measured using Image J software. 449 Schematic of the anticancer mechanisms of CK in SKBR3 cells. ACCEPTED MANUSCRIPT Gene Bcl2 F ACAACATCGCCCTGTGGATGAC R ATAGCTGATTCGACGTTTTGCC GAPDH F CACTCACGGCAAATTCAACGGCA
-
br RNA oligonucleotides and plasmid transfection br
2020-03-24
2.8. RNA oligonucleotides and plasmid transfection Breast cancer Malonyl Coenzyme A were respectively transfected with miR20b agomir, miR-20b inhibitor, MEK siRNA, P38 siRNA or nonspecific siRNA (GenePharma, Shanghai, China) using Lipofectamine 2000 (Invitrogen, USA) according to the manufactu
-
B Machnicka R Grochowalska D M Boguslawska A F
2020-03-24
[16] B. Machnicka, R. Grochowalska, D.M. Boguslawska, A.F. Sikorski, M.C. Lecomte, Spectrin-based skeleton as an actor in cell signaling, Cell. Mol. Life Sci. 69 (2012) 191–201. [17] X. Li, Y. Matsuoka, V. Bennett, Adducin preferentially recruits spectrin to the fast growing ends of Hexa His tag pe