Archives

  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • 2021-03
  • LY3009120 br were stained with crystal violet and their area

    2020-07-06


    445 were stained with 0.5% crystal violet, and their areas were measured using Image J software.
    449 Schematic of the anticancer mechanisms of CK in SKBR3 cells.
    ACCEPTED MANUSCRIPT
    Gene
    Bcl2 F ACAACATCGCCCTGTGGATGAC
    R ATAGCTGATTCGACGTTTTGCC GAPDH F CACTCACGGCAAATTCAACGGCA
    R GACTCCACGACATACTCAGCAC
    C
    C
    Contents lists available at ScienceDirect
    Cellular Signalling
    journal homepage: www.elsevier.com/locate/cellsig
    AKT2 phosphorylation of hexokinase 2 at T473 promotes tumorigenesis and T metastasis in colon cancer cells via NF-κB, HIF1α, MMP2, and MMP9 upregulation
    Hang Lia,1, Shaohong Lub,1, Yu Chena, Longzhi Zhenga, Liangyuan Chenc, Haojie Dingb, Jianzu Dingb, Di Loub, Fangfang Liua, Bin Zhengb, a Department of central laboratory, Affiliated Hospital of Putian University, Putian 351100, Fujian, PR China
    b Zhejiang Academy of Medical Sciences, Hangzhou 310013, Zhejiang, PR China
    c Department of Clinical Laboratory, Fujian Provincial Hospital, Provincial Clinical College of Fujian Medical University, Fuzhou 350025, Fujian, PR China
    Keywords:
    Colon cancer
    AKT2
    Phosphorylation
    Tumorigenesis
    Metastasis 
    It has been well-established that AKT2 plays an important role in the development and progression of colon cancer; however, its precise function remains unclear. In the present study, we found that AKT2 can interact with and phosphorylate hexokinase 2 (HK2), the rate-limiting enzyme in glycolysis. Moreover, threonine phos-phorylation dramatically increases its catalytic activity and enhances glycolysis. Mechanistically, AKT2 phos-phorylation of HK2 at T473 was found to increase hexokinase activity and lactic LY3009120 production. A mutation in the AKT2 phosphorylation site of HK2 substantially reduced the stimulating effects of AKT2 on glycolysis, cellular apoptosis, invasion, tumorigenesis, and metastasis. In addition, AKT2 regulated NF-ΚB, HIF1Α, MMP2, and MMP9 via the phosphorylation of HK2 at the T473 site. Taken together, AKT2 increases the invasion, tumorigenesis, and metastasis of colon cancer cells in vitro and promotes lung metastasis in nude mice in vivo through the phosphorylation of the T473 site of HK2 by upregulating NF-κB, HIF1α, MMP2, and MMP9. In conclusion, our findings highlight a novel mechanism for the AKT2-HK2-NF-κB/HIF1α/MMP2/MMP9 axis in the regulation of colon cancer progression. Moreover, our results suggest that both AKT2 and HK2 may be potential targets for the treatment of colon cancer.
    1. Introduction
    Colon cancer is the third most common malignancy worldwide, and is associated with a high mortality rate [1]. Since an early diagnosis of colon cancer is rare, the presence of invasive or distant metastases of colon cancer cells into the surrounding tissues and the existing treat-ment methods (e.g., surgical resection and/or chemotherapy) cannot completely inhibit the recurrence and metastasis of colon cancer [2]. Epidemiological investigation has revealed that the occurrence and development of colon cancer is closely related to genetics, diet, living environment, intestinal flora, and other factors [3]. Recently, a large number of studies have shown that the dysregulation of various cell signaling pathways play an important role in the occurrence, develop-ment, and metastasis of colon cancer [4]. Therefore, in-depth studies of the molecular mechanism of colon cancer cell-related signal transduc-tion pathways and the development of therapeutic drugs for key
    molecules have been the primary focus of colon cancer research. Protein kinase B (AKT) is at the core of the phosphatidylinositol-3-
    kinase/protein kinase B/mammalian target of rapamycin (P13K/AKT/ mTOR) signal transduction pathway. A variety of growth factors, in-sulin, cytokines, and other mediators can stimulate AKT activation via the P13K/AKT/mTOR pathway. Subsequently, activated AKT can pro-mote the growth and reproduction of tumor cells, inhibit cell apoptosis, promote cancer cell invasion and metastasis, and promote angiogenesis [5]. Currently, three subtypes of AKT that have been identified (i.e., PKBα [AKT1], PKBβ [AKT2], and PKBγ [AKT3]), which play an im-portant role in tumor occurrence and development. Among these three subtypes, AKT2 is closely associated with cancer cell invasion, metas-tasis, angiogenesis, survival, and drug resistance [6]. Moreover, studies have shown that AKT2 is often overexpressed in colon cancer tissues and cells [7]. Although recent studies on the development of activated AKT and tumors have made significant progress [8], a large number of
    Corresponding author at: Zhejiang Academy of Medical Sciences, Hangzhou 310013, Zhejiang, PR China.